ID: 1085048539_1085048554

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1085048539 1085048554
Species Human (GRCh38) Human (GRCh38)
Location 11:73367622-73367644 11:73367669-73367691
Sequence CCTTGGCACCGAGGCCCCGCCCC CAGTGGAGGTGATGGCTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 418} {0: 1, 1: 0, 2: 3, 3: 44, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!