ID: 1085051836_1085051846

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085051836 1085051846
Species Human (GRCh38) Human (GRCh38)
Location 11:73383976-73383998 11:73384007-73384029
Sequence CCTGTGTCCAGCTGTGTTTCCAG AGCCTCTGGAGGCCAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 233} {0: 1, 1: 0, 2: 4, 3: 53, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!