ID: 1085051959_1085051962

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085051959 1085051962
Species Human (GRCh38) Human (GRCh38)
Location 11:73384562-73384584 11:73384600-73384622
Sequence CCACAGAGCCAGTGCAAGACAGA ACCCCATACTTTGTATCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 317} {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!