ID: 1085069955_1085069964

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1085069955 1085069964
Species Human (GRCh38) Human (GRCh38)
Location 11:73534980-73535002 11:73535033-73535055
Sequence CCACAGGCAGCCAGGCCTCCAAC GAGAATCTGACCAGCCCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 388} {0: 1, 1: 0, 2: 1, 3: 19, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!