ID: 1085083623_1085083637

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1085083623 1085083637
Species Human (GRCh38) Human (GRCh38)
Location 11:73652549-73652571 11:73652591-73652613
Sequence CCAACAAAGGCCCCATTGTCCCG AGGCTCTGGGGTCAGAGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81} {0: 1, 1: 0, 2: 6, 3: 37, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!