ID: 1085100451_1085100458

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1085100451 1085100458
Species Human (GRCh38) Human (GRCh38)
Location 11:73796117-73796139 11:73796138-73796160
Sequence CCTGCCCCTTCCGAGTTGGGGCG CGGTGCCCAAGTCATGGCTGTGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 35, 3: 102, 4: 276} {0: 1, 1: 0, 2: 3, 3: 23, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!