ID: 1085125450_1085125458

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1085125450 1085125458
Species Human (GRCh38) Human (GRCh38)
Location 11:73999050-73999072 11:73999080-73999102
Sequence CCCCCGAGTAGCTGGGACCGCAG TCACCATGCCTGGCTAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 98, 2: 1576, 3: 5825, 4: 9204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!