ID: 1085163669_1085163678

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1085163669 1085163678
Species Human (GRCh38) Human (GRCh38)
Location 11:74374734-74374756 11:74374756-74374778
Sequence CCTGCCATTCACTGAGTCCCCAA AAGGAGAAAGGGCCTGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 270} {0: 1, 1: 0, 2: 1, 3: 32, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!