ID: 1085171813_1085171818

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1085171813 1085171818
Species Human (GRCh38) Human (GRCh38)
Location 11:74456118-74456140 11:74456169-74456191
Sequence CCAGCCTGGGCAACATGTGAAAC TATATATATATAAATTAACTGGG
Strand - +
Off-target summary {0: 34, 1: 326, 2: 1368, 3: 11678, 4: 72278} {0: 1, 1: 46, 2: 201, 3: 984, 4: 9915}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!