ID: 1085171814_1085171818

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1085171814 1085171818
Species Human (GRCh38) Human (GRCh38)
Location 11:74456122-74456144 11:74456169-74456191
Sequence CCTGGGCAACATGTGAAACCCTG TATATATATATAAATTAACTGGG
Strand - +
Off-target summary {0: 12, 1: 131, 2: 393, 3: 1208, 4: 4211} {0: 1, 1: 46, 2: 201, 3: 984, 4: 9915}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!