|
Left Crispr |
Right Crispr |
| Crispr ID |
1085171815 |
1085171820 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:74456140-74456162
|
11:74456181-74456203
|
| Sequence |
CCCTGTCTCTACTTAAATATATA |
AATTAACTGGGTGTGGTGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 455, 3: 7440, 4: 22355} |
{0: 5, 1: 303, 2: 7448, 3: 27788, 4: 60818} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|