|
Left Crispr |
Right Crispr |
| Crispr ID |
1085171816 |
1085171818 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:74456141-74456163
|
11:74456169-74456191
|
| Sequence |
CCTGTCTCTACTTAAATATATAT |
TATATATATATAAATTAACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 16, 2: 135, 3: 1461, 4: 18583} |
{0: 1, 1: 46, 2: 201, 3: 984, 4: 9915} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|