ID: 1085212219_1085212231

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085212219 1085212231
Species Human (GRCh38) Human (GRCh38)
Location 11:74791487-74791509 11:74791525-74791547
Sequence CCAAGCTGCTCTCAGCACCCCCA CCTCTGGGGTGCCCAAAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 88, 4: 576} {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!