ID: 1085212220_1085212231

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1085212220 1085212231
Species Human (GRCh38) Human (GRCh38)
Location 11:74791504-74791526 11:74791525-74791547
Sequence CCCCCACAGCCTTCCTCCTGTCC CCTCTGGGGTGCCCAAAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 858} {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!