ID: 1085229298_1085229305

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1085229298 1085229305
Species Human (GRCh38) Human (GRCh38)
Location 11:74950834-74950856 11:74950870-74950892
Sequence CCATGCACCTGGCCTCACACTCA AGAAACATATTCTGGAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 354} {0: 1, 1: 0, 2: 3, 3: 26, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!