ID: 1085232942_1085232956

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1085232942 1085232956
Species Human (GRCh38) Human (GRCh38)
Location 11:74988775-74988797 11:74988808-74988830
Sequence CCCACGCCGTGGTGGGGACCGAG GAGGGAGGGGCAGCGCCGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66} {0: 1, 1: 0, 2: 5, 3: 69, 4: 536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!