ID: 1085250603_1085250607

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1085250603 1085250607
Species Human (GRCh38) Human (GRCh38)
Location 11:75141135-75141157 11:75141170-75141192
Sequence CCATTTGCATTGGAGCATTGGAG GTGAACAGGAGGAAGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117} {0: 1, 1: 0, 2: 3, 3: 42, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!