ID: 1085253489_1085253501

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1085253489 1085253501
Species Human (GRCh38) Human (GRCh38)
Location 11:75159222-75159244 11:75159275-75159297
Sequence CCGACTGACAGTCAGACACACAG CCCTAGCCCCTGGAGCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 361} {0: 1, 1: 0, 2: 3, 3: 22, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!