ID: 1085269247_1085269254

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1085269247 1085269254
Species Human (GRCh38) Human (GRCh38)
Location 11:75260564-75260586 11:75260583-75260605
Sequence CCACCTCTCCTATGACCCTTGCA TGCAATTGTCCCAGTGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 226} {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!