ID: 1085272467_1085272475

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1085272467 1085272475
Species Human (GRCh38) Human (GRCh38)
Location 11:75278431-75278453 11:75278471-75278493
Sequence CCAAGAGGCTTCTCCAAATCCCC TCCCTGACCCCTGTGGTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 181} {0: 1, 1: 0, 2: 2, 3: 29, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!