ID: 1085273194_1085273198

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1085273194 1085273198
Species Human (GRCh38) Human (GRCh38)
Location 11:75282392-75282414 11:75282428-75282450
Sequence CCTGGATGATTTTGGTGGGCCTA AGTCCTTAGAAGTGGAAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 348} {0: 1, 1: 0, 2: 0, 3: 16, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!