ID: 1085273194_1085273200

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085273194 1085273200
Species Human (GRCh38) Human (GRCh38)
Location 11:75282392-75282414 11:75282430-75282452
Sequence CCTGGATGATTTTGGTGGGCCTA TCCTTAGAAGTGGAAGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 348} {0: 1, 1: 1, 2: 21, 3: 105, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!