ID: 1085291087_1085291097

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1085291087 1085291097
Species Human (GRCh38) Human (GRCh38)
Location 11:75399944-75399966 11:75399988-75400010
Sequence CCTTAACTGGTCGTTTCTGGGTA TCAACTTGAAGGGTTGCTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65} {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
21 11:75399944-75399966 CCTTAACTGGTCGTTTCTGGGTA - 11:75399988-75400010 TCAACTTGAAGGGTTGCTGACGG +