ID: 1085301531_1085301544

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1085301531 1085301544
Species Human (GRCh38) Human (GRCh38)
Location 11:75461822-75461844 11:75461869-75461891
Sequence CCAAGCCCCAGCTGTCCCCAACT CTTATCTGTCAGTAGAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 40, 4: 439} {0: 1, 1: 0, 2: 2, 3: 14, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!