ID: 1085301538_1085301544

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085301538 1085301544
Species Human (GRCh38) Human (GRCh38)
Location 11:75461838-75461860 11:75461869-75461891
Sequence CCCAACTGGCTGTGTGACCTGGG CTTATCTGTCAGTAGAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 49, 3: 213, 4: 821} {0: 1, 1: 0, 2: 2, 3: 14, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!