ID: 1085307018_1085307027

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1085307018 1085307027
Species Human (GRCh38) Human (GRCh38)
Location 11:75492252-75492274 11:75492274-75492296
Sequence CCTCCAGCCTGTGCCCACTGCCC CTGTGTCAGGTCACCCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 126, 4: 911} {0: 1, 1: 0, 2: 3, 3: 28, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!