ID: 1085319725_1085319731

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1085319725 1085319731
Species Human (GRCh38) Human (GRCh38)
Location 11:75566480-75566502 11:75566508-75566530
Sequence CCGAGCGCAGCGCCGGCCTGGCC CTTGTACCAGGCCATGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 260} {0: 1, 1: 1, 2: 4, 3: 67, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!