ID: 1085332486_1085332487

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1085332486 1085332487
Species Human (GRCh38) Human (GRCh38)
Location 11:75665725-75665747 11:75665751-75665773
Sequence CCGCTTGGTAGCAGCATAAAAAC GTGAACATTCTACCATCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 132} {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!