ID: 1085346327_1085346332

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1085346327 1085346332
Species Human (GRCh38) Human (GRCh38)
Location 11:75770339-75770361 11:75770379-75770401
Sequence CCCTCTTGGTGTGGGTGCTGCTC ACCCAGCTGCTGCCCTGTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 188} {0: 1, 1: 2, 2: 19, 3: 107, 4: 672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!