ID: 1085346359_1085346365

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1085346359 1085346365
Species Human (GRCh38) Human (GRCh38)
Location 11:75770532-75770554 11:75770558-75770580
Sequence CCTTGTTCATGCTGTTAAAAATG TTGCACTGGGCAGTGGGATAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 655} {0: 1, 1: 0, 2: 0, 3: 25, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!