ID: 1085395744_1085395746

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1085395744 1085395746
Species Human (GRCh38) Human (GRCh38)
Location 11:76206380-76206402 11:76206395-76206417
Sequence CCTCGCAGACCTGCGGCCGCGCC GCCGCGCCCTCATCGTCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 163} {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!