ID: 1085401188_1085401195

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1085401188 1085401195
Species Human (GRCh38) Human (GRCh38)
Location 11:76236442-76236464 11:76236462-76236484
Sequence CCAAAATGGAGACCTCTTGGCCG CCGCGCGGCGGAGGGAGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!