ID: 1085402934_1085402941

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1085402934 1085402941
Species Human (GRCh38) Human (GRCh38)
Location 11:76245420-76245442 11:76245455-76245477
Sequence CCTGGTGCCTTTTGGGAACAGAA GCTGAAGCCCAGAGGGTAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!