ID: 1085431543_1085431561

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1085431543 1085431561
Species Human (GRCh38) Human (GRCh38)
Location 11:76454918-76454940 11:76454970-76454992
Sequence CCCTCCTCCCCCTCCTAATACTG AGTACCTCTAGTCAGAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 494} {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!