ID: 1085431631_1085431637

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1085431631 1085431637
Species Human (GRCh38) Human (GRCh38)
Location 11:76455586-76455608 11:76455625-76455647
Sequence CCTGAAGGAATGTGGTTGAAAGG AAGATTGAGCACAAAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175} {0: 1, 1: 0, 2: 2, 3: 26, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!