ID: 1085452008_1085452012

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1085452008 1085452012
Species Human (GRCh38) Human (GRCh38)
Location 11:76639792-76639814 11:76639829-76639851
Sequence CCCAAGCAAGGTCAGATGGTGCC AGATGCAGAAAGTCACAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 112} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!