ID: 1085452968_1085452974

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1085452968 1085452974
Species Human (GRCh38) Human (GRCh38)
Location 11:76648014-76648036 11:76648029-76648051
Sequence CCTGTCCCCTTCACTCTGGCTGA CTGGCTGAGGGTCCTTCTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!