ID: 1085474819_1085474838

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1085474819 1085474838
Species Human (GRCh38) Human (GRCh38)
Location 11:76783256-76783278 11:76783285-76783307
Sequence CCGCCACCCGGCGCCCGGCAGGG CTGGCTGCGGGCGGGGACCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 303} {0: 1, 1: 0, 2: 5, 3: 43, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!