ID: 1085474819_1085474844

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1085474819 1085474844
Species Human (GRCh38) Human (GRCh38)
Location 11:76783256-76783278 11:76783304-76783326
Sequence CCGCCACCCGGCGCCCGGCAGGG GGGGGGCGGGCCGCGCCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 303} {0: 1, 1: 0, 2: 7, 3: 108, 4: 750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!