ID: 1085499987_1085499997

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1085499987 1085499997
Species Human (GRCh38) Human (GRCh38)
Location 11:77011414-77011436 11:77011463-77011485
Sequence CCCCCACTGATCATATTCCTGTC CAGAAGCCTTCACTGTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 178} {0: 1, 1: 0, 2: 0, 3: 20, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!