ID: 1085505028_1085505034

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1085505028 1085505034
Species Human (GRCh38) Human (GRCh38)
Location 11:77053510-77053532 11:77053559-77053581
Sequence CCTGCTGGGCTGCATCCACAGGA AGATAGGAGATCAGTGTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 94, 3: 433, 4: 719} {0: 1, 1: 0, 2: 1, 3: 11, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!