ID: 1085508443_1085508456

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1085508443 1085508456
Species Human (GRCh38) Human (GRCh38)
Location 11:77073301-77073323 11:77073346-77073368
Sequence CCTGTCCTGCCCAAGGCCTGCAG TTTCAGAAGCTCCTCTCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 420} {0: 1, 1: 0, 2: 3, 3: 29, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!