ID: 1085509655_1085509658

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1085509655 1085509658
Species Human (GRCh38) Human (GRCh38)
Location 11:77081837-77081859 11:77081854-77081876
Sequence CCTGCTGCAGCAGACCTGAGTGC GAGTGCTGGCGTCTGTGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 217} {0: 1, 1: 0, 2: 2, 3: 38, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!