ID: 1085516683_1085516692

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085516683 1085516692
Species Human (GRCh38) Human (GRCh38)
Location 11:77115875-77115897 11:77115906-77115928
Sequence CCTCTGTGCTTGGCTTATGGCCC CCAAGATGGGAGTGGAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 461} {0: 1, 1: 0, 2: 2, 3: 36, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!