ID: 1085520113_1085520117

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1085520113 1085520117
Species Human (GRCh38) Human (GRCh38)
Location 11:77132775-77132797 11:77132816-77132838
Sequence CCGCACCAGGTGGATAGAGGTTT ATGATGAAACAGGCTCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101} {0: 1, 1: 2, 2: 23, 3: 151, 4: 683}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!