ID: 1085532697_1085532699

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085532697 1085532699
Species Human (GRCh38) Human (GRCh38)
Location 11:77201371-77201393 11:77201402-77201424
Sequence CCTCAGTTCTTCTGTGGGAAGAT TCAGCCTGTCTCTGCCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 260} {0: 1, 1: 0, 2: 2, 3: 44, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!