ID: 1085533029_1085533039

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1085533029 1085533039
Species Human (GRCh38) Human (GRCh38)
Location 11:77202903-77202925 11:77202946-77202968
Sequence CCTCGGGTCACATGCAGGGCAGG CACTCTCAGCCTCTGGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 304} {0: 1, 1: 0, 2: 0, 3: 23, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!