ID: 1085556467_1085556470

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1085556467 1085556470
Species Human (GRCh38) Human (GRCh38)
Location 11:77427185-77427207 11:77427203-77427225
Sequence CCTAAGTGTCTCTGCAGAGACAG GACAGACTGAGGGTCTCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 261} {0: 1, 1: 0, 2: 0, 3: 15, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!