ID: 1085584339_1085584345

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1085584339 1085584345
Species Human (GRCh38) Human (GRCh38)
Location 11:77687459-77687481 11:77687494-77687516
Sequence CCCACCTTGGGTAACCTTGGGTA CTAGGCATTTGAGACCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83} {0: 1, 1: 3, 2: 53, 3: 723, 4: 7323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!