ID: 1085599513_1085599524

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085599513 1085599524
Species Human (GRCh38) Human (GRCh38)
Location 11:77842561-77842583 11:77842599-77842621
Sequence CCTATAAGGACTGCAAAGTATGG ACTTGGGATTGGAGAGAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 106} {0: 1, 1: 0, 2: 0, 3: 38, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!